Update on technical post

So I found some more inserts in the right orientation for one of the two deletions I complained about earlier, and the sequencing data is in.

Initial clone: 5 bp deletion (4 in primer, 1 in vector)

2 out of 4 clones: 3 bp deletion (all in primer)

2 out of 4 clones: no deletion

For my reference: Vector sequence going into it: 5' CCCTT 3', where the last T is an overhang

Primer sequence: 5' CCAATCGAAATCATCCTTGCC 3'

Eaten in the first instance: CCAA in primer, T overhang in vector

Eaten in the other two instances: CCA in primer, nothing in vector


Tentative conclusion: Deletion has to do with the sequence of the primer.  Weird-ass TA cloning...

------------

I've probably bored you all to tears, haven't I?