Update on technical post

[amethyst73]

So I found some more inserts in the right orientation for one of the two deletions I complained about earlier, and the sequencing data is in.

Initial clone: 5 bp deletion (4 in primer, 1 in vector)

2 out of 4 clones: 3 bp deletion (all in primer)

2 out of 4 clones: no deletion

For my reference: Vector sequence going into it: 5' CCCTT 3', where the last T is an overhang

Primer sequence: 5' CCAATCGAAATCATCCTTGCC 3'

Eaten in the first instance: CCAA in primer, T overhang in vector

Eaten in the other two instances: CCA in primer, nothing in vector


Tentative conclusion: Deletion has to do with the sequence of the primer.  Weird-ass TA cloning...

------------

I've probably bored you all to tears, haven't I?

Comments

[nezumiko.livejournal.com]

Bored? No, not really. Baffled? Yes, quite a bit.

The primer they used to create the clones caused problems? Is this like using an oil-based primer under latex paint?

[amethyst73.livejournal.com]

Uh, no, not quite.

Remind me to tell you about PCR (http://en.wikipedia.org/wiki/PCR) next time I see you. :)

[digitalemur.livejournal.com]

I don't think I understand what the vector sequence is-- the problem is that I've gotten too used to amplifying sequences from whole DNA for genetics labs and I don't remember enough about vector cloning. But, uhh... yeah I guess there's problem with the primer? Honey, I dunno. Like I said, I'm used to doing primer design based on the sequence to be amplified and it... sounds like you're doing something more complex? Or I'm forgetting some other first principle because it has been years? *fails at molecular biology*

But I'm LOVING hearing you talk about it! This is awesome!

[emilymorgan.livejournal.com]

agreed!

[resonance42.livejournal.com]

HA.

Reminds me of my own personal hell doing something similar...

Good luck!