Update on technical post

Oct. 8th, 2008 04:26 pm
amethyst73: (Default)
[personal profile] amethyst73
So I found some more inserts in the right orientation for one of the two deletions I complained about earlier, and the sequencing data is in.

Initial clone: 5 bp deletion (4 in primer, 1 in vector)

2 out of 4 clones: 3 bp deletion (all in primer)

2 out of 4 clones: no deletion

For my reference: Vector sequence going into it: 5' CCCTT 3', where the last T is an overhang

Primer sequence: 5' CCAATCGAAATCATCCTTGCC 3'

Eaten in the first instance: CCAA in primer, T overhang in vector

Eaten in the other two instances: CCA in primer, nothing in vector


Tentative conclusion: Deletion has to do with the sequence of the primer.  Weird-ass TA cloning...

------------

I've probably bored you all to tears, haven't I?

Date: 2008-10-09 12:07 am (UTC)
From: [identity profile] nezumiko.livejournal.com
Bored? No, not really. Baffled? Yes, quite a bit.

The primer they used to create the clones caused problems? Is this like using an oil-based primer under latex paint?

Date: 2008-10-09 12:58 am (UTC)
From: [identity profile] amethyst73.livejournal.com
Uh, no, not quite.

Remind me to tell you about PCR (http://en.wikipedia.org/wiki/PCR) next time I see you. :)

Date: 2008-10-09 01:58 am (UTC)
From: [identity profile] digitalemur.livejournal.com
I don't think I understand what the vector sequence is-- the problem is that I've gotten too used to amplifying sequences from whole DNA for genetics labs and I don't remember enough about vector cloning. But, uhh... yeah I guess there's problem with the primer? Honey, I dunno. Like I said, I'm used to doing primer design based on the sequence to be amplified and it... sounds like you're doing something more complex? Or I'm forgetting some other first principle because it has been years? *fails at molecular biology*

But I'm LOVING hearing you talk about it! This is awesome!

Date: 2008-10-09 02:02 am (UTC)

Date: 2008-10-09 05:49 pm (UTC)
From: [identity profile] resonance42.livejournal.com
HA.

Reminds me of my own personal hell doing something similar...

Good luck!

Profile

amethyst73: (Default)
amethyst73

January 2026

S M T W T F S
    123
45678910
11121314151617
1819202122 2324
25262728293031

Most Popular Tags

Style Credit

Expand Cut Tags

No cut tags
Page generated Feb. 9th, 2026 06:14 am
Powered by Dreamwidth Studios