Update on technical post
Oct. 8th, 2008 04:26 pmSo I found some more inserts in the right orientation for one of the two deletions I complained about earlier, and the sequencing data is in.
Initial clone: 5 bp deletion (4 in primer, 1 in vector)
2 out of 4 clones: 3 bp deletion (all in primer)
2 out of 4 clones: no deletion
For my reference: Vector sequence going into it: 5' CCCTT 3', where the last T is an overhang
Primer sequence: 5' CCAATCGAAATCATCCTTGCC 3'
Eaten in the first instance: CCAA in primer, T overhang in vector
Eaten in the other two instances: CCA in primer, nothing in vector
Tentative conclusion: Deletion has to do with the sequence of the primer. Weird-ass TA cloning...
------------
I've probably bored you all to tears, haven't I?
Initial clone: 5 bp deletion (4 in primer, 1 in vector)
2 out of 4 clones: 3 bp deletion (all in primer)
2 out of 4 clones: no deletion
For my reference: Vector sequence going into it: 5' CCCTT 3', where the last T is an overhang
Primer sequence: 5' CCAATCGAAATCATCCTTGCC 3'
Eaten in the first instance: CCAA in primer, T overhang in vector
Eaten in the other two instances: CCA in primer, nothing in vector
Tentative conclusion: Deletion has to do with the sequence of the primer. Weird-ass TA cloning...
------------
I've probably bored you all to tears, haven't I?
no subject
Date: 2008-10-09 12:07 am (UTC)The primer they used to create the clones caused problems? Is this like using an oil-based primer under latex paint?
no subject
Date: 2008-10-09 12:58 am (UTC)Remind me to tell you about PCR (http://en.wikipedia.org/wiki/PCR) next time I see you. :)